About   Help   FAQ
D7Mit46 Primer Detail
Primers
  • Name
    D7Mit46
  • Primer 1 Sequence
    AATAGAACTTAATTGGCACAAGCC
  • Primer 2 Sequence
    CAATTATGTGGGTGTGCATACC
  • ID
    MGI:703940
  • Product Size
    182
  • Other IDs
    D7Mit46 (BROAD)
  • Note
    MIT assay: D551
    Additional information: MIT STS Marker Data Files
Genes
D7Mit46 DNA segment, Chr 7, Massachusetts Institute of Technology 46
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit46 a 182bp A/J, B6.Cg-Lepob/+
b 184bp AKR/J, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac
c 190bp CAST/EiJ
d 192bp SPRET/EiJ
e 196bp BALB/cJ
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D7Mit46 c 195bp BALB/cJ
d 181bp 129P3/J, A/JOlaHsd, AKR/OlaHsd, C3H/HeJ, C57BL/6JOlaHsd, C57BL/10, DBA/2J, PWB, SJL/J
j 187bp JF1
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/28/2024
MGI 6.13
The Jackson Laboratory