D7Mit44 Primer Detail MGI Mouse MGI:703938

D7Mit44 Primer Detail

Name

D7Mit44
Primer 1 Sequence

TTCTGGCCTCTGTGAAGTAGTG
Primer 2 Sequence

GTGAAACCATGGTGCAGATG
ID

MGI:703938
Product Size

188
Other IDs

D7Mit44 (BROAD)
Note

MIT assay: A733
Additional information: MIT STS Marker Data Files

D7Mit44

DNA segment, Chr 7, Massachusetts Institute of Technology 44

J:40661 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):390-3

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D7Mit44	a	170bp	129P1/ReJ, 129P3/J, 129P4/RrRkJ, 129S/SvEv, 129T1/Sv-Dnd1^Ter, 129X1/Sv, 129X1/SvJ
Not Specified	D7Mit44	b	190bp	129P2/Ola, C3HeB/FeJ, C57BL/6J

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D7Mit44	a	170bp	129X1/Sv
Not Specified	D7Mit44	b	190, 198bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D7Mit44	a	170bp	LP/J
	b	188bp	B6.Cg-Lep^ob/+
	c	190bp	AKR/J, BALB/cJ, C3H/HeJ, C57BL/6J, CAST/EiJ, DBA/2J, NOD/MrkTac, SPRET/EiJ
	d	192bp	A/J
	e	198bp	NON/ShiLt

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D7Mit44	c	not given	C58/J
	f	not given	FVB/NJ
	i	smaller	I/LnJ

J:40661 Threadgill DW, et al., Genealogy of the 129 inbred strains: 129/SvJ is a contaminated inbred strain. Mamm Genome. 1997 Jun;8(6):390-3

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 03/18/2025 MGI 6.24