About   Help   FAQ
D7Mit44 Primer Detail
Primers
  • Name
    D7Mit44
  • Primer 1 Sequence
    TTCTGGCCTCTGTGAAGTAGTG
  • Primer 2 Sequence
    GTGAAACCATGGTGCAGATG
  • ID
    MGI:703938
  • Product Size
    188
  • Other IDs
    D7Mit44 (BROAD)
  • Note
    MIT assay: A733
    Additional information: MIT STS Marker Data Files
Genes
D7Mit44 DNA segment, Chr 7, Massachusetts Institute of Technology 44
Polymorphisms
J:40661 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):390-3
Endonuclease Gene Allele Fragments Strains
Not Specified D7Mit44 a 170bp 129P1/ReJ, 129P3/J, 129P4/RrRkJ, 129S/SvEv, 129T1/Sv-Dnd1Ter, 129X1/Sv, 129X1/SvJ
b 190bp 129P2/Ola, C3HeB/FeJ, C57BL/6J
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D7Mit44 a 170bp 129X1/Sv
b 190, 198bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit44 a 170bp LP/J
b 188bp B6.Cg-Lepob/+
c 190bp AKR/J, BALB/cJ, C3H/HeJ, C57BL/6J, CAST/EiJ, DBA/2J, NOD/MrkTac, SPRET/EiJ
d 192bp A/J
e 198bp NON/ShiLt
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D7Mit44 c not given C58/J
f not given FVB/NJ
i smaller I/LnJ
References
J:40661 Threadgill DW, et al., Genealogy of the 129 inbred strains: 129/SvJ is a contaminated inbred strain. Mamm Genome. 1997 Jun;8(6):390-3
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory