About   Help   FAQ
D7Mit40 Primer Detail
Primers
  • Name
    D7Mit40
  • Primer 1 Sequence
    GTCAACAGTCAGGAAAGCTGG
  • Primer 2 Sequence
    CAGATGCTTGTATTTGCAAAGC
  • ID
    MGI:703935
  • Product Size
    201
  • Other IDs
    D7Mit40 (BROAD)
  • Note
    MIT assay: B326
    Additional information: MIT STS Marker Data Files
Genes
D7Mit40 DNA segment, Chr 7, Massachusetts Institute of Technology 40
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit40 a 200bp CAST/EiJ
b 204bp A/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
c 220bp LP/J
d 228bp AKR/J, C3H/HeJ, DBA/2J
e 248bp SPRET/EiJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D7Mit40 a 228bp AKR/W, BN/aW, C3H/W, CBA/W, DBA/2W
b 220bp 129/SvW
c 204bp A.CA/W, BALB/cW, C57BL/6W, C57BL/10W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
07/08/2026
MGI 6.24
The Jackson Laboratory