About   Help   FAQ
DXMit141 Primer Detail
Primers
  • Name
    DXMit141
  • Primer 1 Sequence
    CTCAGAGACTTGAGACGTAATTTCC
  • Primer 2 Sequence
    ATTCATTCTCCAACAAAGGGG
  • ID
    MGI:703921
  • Product Size
    144
  • Other IDs
    DXMit141 (BROAD)
  • Note
    MIT assay: MT2779
    Additional information: MIT STS Marker Data Files
Genes
DXMit141 DNA segment, Chr X, Massachusetts Institute of Technology 141
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified DXMit141 a 150bp 129P2/Ola, 129P3/J, 129T1/Sv-Dnd1Ter, 129X1/Sv
b 154bp 129X1/SvJ
c 134bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit141 a 122bp CAST/EiJ
b 130bp LP/J
c 132bp A/J, AKR/J, C3H/HeJ, DBA/2J, NOD/MrkTac
d 134bp BALB/cJ
e 136bp B6.Cg-Lepob/+, C57BL/6J, SPRET/EiJ
f 138bp NON/ShiLt
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
DXMit141 c larger C58/J
f not given FVB/NJ
i not given I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
DXMit141 c 122bp CBA/CaOlaHsd
s 112bp SWR/OlaHsd
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory