D16Mit101 Primer Detail MGI Mouse MGI:703904

D16Mit101 Primer Detail

Name

D16Mit101
Primer 1 Sequence

TTATGAAATGTTTTATCTTTTGGGG
Primer 2 Sequence

CTCCAGATGTAGAAATTAAAATCTTGG
ID

MGI:703904
Product Size

150
Other IDs

D16Mit101 (BROAD)
Note

MIT assay: MT1366
Additional information: MIT STS Marker Data Files

DNA segment, Chr 16, Massachusetts Institute of Technology 101

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit101	a	140bp	CAST/EiJ
	b	146bp	C3H/HeJ, DBA/2J
	c	150bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
	d	162bp	SPRET/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D16Mit101	a	155bp	A.CA/W, AKR/W, BALB/cW, BN/aW, C57BL/6W, C57BL/10W
	D16Mit101	b	150bp	129/SvW, C3H/W, CBA/W, DBA/2W

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D16Mit101	c	smaller	CBA/Kw
	D16Mit101	e	larger	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24