D16Mit103 Primer Detail MGI Mouse MGI:703902

D16Mit103 Primer Detail

Name

D16Mit103
Primer 1 Sequence

GGTGTGCATACACACATGCA
Primer 2 Sequence

TGACTAGACTTGACTCCTCCACC
ID

MGI:703902
Product Size

112
Other IDs

D16Mit103 (BROAD)
Note

MIT assay: MT1766
Additional information: MIT STS Marker Data Files

DNA segment, Chr 16, Massachusetts Institute of Technology 103

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit103	a	103bp	AKR/J, C57BL/6J, NOD/MrkTac, NON/ShiLt
	b	111bp	B6.Cg-Lep^ob/+, C3H/HeJ
	c	121bp	BALB/cJ, DBA/2J
	d	123bp	CAST/EiJ
	e	133bp	A/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D16Mit103	a	130bp	AKR/W
	b	126bp	C3H/W, CBA/W, DBA/2W
	c	111bp	129/SvW, A.CA/W, BALB/cW, BN/aW, C57BL/6W, C57BL/10W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13