About   Help   FAQ
D16Mit103 Primer Detail
Primers
  • Name
    D16Mit103
  • Primer 1 Sequence
    GGTGTGCATACACACATGCA
  • Primer 2 Sequence
    TGACTAGACTTGACTCCTCCACC
  • ID
    MGI:703902
  • Product Size
    112
  • Other IDs
    D16Mit103 (BROAD)
  • Note
    MIT assay: MT1766
    Additional information: MIT STS Marker Data Files
Genes
D16Mit103 DNA segment, Chr 16, Massachusetts Institute of Technology 103
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D16Mit103 a 103bp AKR/J, C57BL/6J, NOD/MrkTac, NON/ShiLt
b 111bp B6.Cg-Lepob/+, C3H/HeJ
c 121bp BALB/cJ, DBA/2J
d 123bp CAST/EiJ
e 133bp A/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D16Mit103 a 130bp AKR/W
b 126bp C3H/W, CBA/W, DBA/2W
c 111bp 129/SvW, A.CA/W, BALB/cW, BN/aW, C57BL/6W, C57BL/10W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory