D16Mit106 Primer Detail MGI Mouse MGI:703899

D16Mit106 Primer Detail

Name

D16Mit106
Primer 1 Sequence

GTTGTTGGTCCACCATACCC
Primer 2 Sequence

GGGTATGAGGTACAATGCTTTACC
ID

MGI:703899
Product Size

146
Other IDs

D16Mit106 (BROAD)
Note

MIT assay: MT1790
Additional information: MIT STS Marker Data Files

DNA segment, Chr 16, Massachusetts Institute of Technology 106

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit106	a	140bp	A/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	b	148bp	B6.Cg-Lep^ob/+, C57BL/6J
	c	158bp	AKR/J
	d	162bp	CAST/EiJ, SPRET/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D16Mit106	a	168bp	AKR/W
	b	158bp	129/SvW
	c	148bp	C57BL/6W, C57BL/10W
	d	136bp	A.CA/W, BALB/cW, BN/aW, C3H/W, CBA/W, DBA/2W

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D16Mit106	c	smaller	CBA/Kw
	D16Mit106	e	larger	KE

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13