About   Help   FAQ
DXMit17 Primer Detail
Primers
  • Name
    DXMit17
  • Primer 1 Sequence
    CCTGTTTGGGCACCTAGATT
  • Primer 2 Sequence
    TAATAACCCATGTTTTCTGTGGG
  • ID
    MGI:703868
  • Product Size
    200
  • Other IDs
    DXMit17 (BROAD)
  • Note
    MIT assay: B350
    Additional information: MIT STS Marker Data Files
Genes
DXMit17 DNA segment, Chr X, Massachusetts Institute of Technology 17
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified DXMit17 m 258bp MOLF/EiJ
s 222bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit17 a 194bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
b 210bp SPRET/EiJ
c 228bp CAST/EiJ
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory