D6Mit183 Primer Detail MGI Mouse MGI:703861

D6Mit183 Primer Detail

Name

D6Mit183
Primer 1 Sequence

TTCTCAATGAACACTAGAACATTCG
Primer 2 Sequence

AAAACACAGGTAGAAAACATACATACA
ID

MGI:703861
Product Size

104
Other IDs

D6Mit183 (BROAD)
Note

MIT assay: MT2304
Additional information: MIT STS Marker Data Files

D6Mit183

DNA segment, Chr 6, Massachusetts Institute of Technology 183

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit183	a	98bp	C3H/HeJ, DBA/2J, LP/J, NON/ShiLt
	b	100bp	AKR/J
	c	104bp	C57BL/6J
	d	106bp	B6.Cg-Lep^ob/+
	e	108bp	CAST/EiJ
	f	162bp	A/J, BALB/cJ
	g	166bp	NOD/MrkTac

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D6Mit183	b	102bp	C57BL/6JOlaHsd, C57BL/10
	c	156bp	A/JOlaHsd, BALB/cJ
	d	94bp	129P3/J, AKR/OlaHsd, C3H/HeJ, DBA/2J
	j	190bp	JF1
	l	96bp	SJL/J
	p	170bp	PWB

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23