About   Help   FAQ
D6Mit184 Primer Detail
Primers
  • Name
    D6Mit184
  • Primer 1 Sequence
    TTTGATAGAATTTAAATCTTTGTGTGC
  • Primer 2 Sequence
    CTGAGGATGACATCCAAGTCTG
  • ID
    MGI:703856
  • Product Size
    129
  • Other IDs
    D6Mit184 (BROAD)
  • Note
    MIT assay: MT2279
    Additional information: MIT STS Marker Data Files
Genes
D6Mit184 DNA segment, Chr 6, Massachusetts Institute of Technology 184
Polymorphisms
J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61
Endonuclease Gene Allele Fragments Strains
Not Specified D6Mit184 b 0.132kb B10.BR-H2k, B10.D2-H2d, BALB/cJ, C57BL/6
c 0.119kb BALB.K-H2k, BALB/cAnNCr, BALB/cByJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D6Mit184 a 119bp A/J, BALB/cJ, CAST/EiJ, NOD/MrkTac
b 132bp AKR/J, B6.Cg-Lepob/+, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NON/ShiLt
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D6Mit184 a 132bp 129/SvW, AKR/W, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
b 119bp A.CA/W, BALB/cW
References
J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory