D11Mit12 Primer Detail MGI Mouse MGI:703850

D11Mit12 Primer Detail

Name

D11Mit12
Primer 1 Sequence

AGGGTTATGCTCTTGGCTGC
Primer 2 Sequence

GATTTTCCTAGGCTGGCTGG
ID

MGI:703850
Product Size

139
Other IDs

D11Mit12 (BROAD)
Note

MIT assay: L3
Additional information: MIT STS Marker Data Files

D11Mit12

DNA segment, Chr 11, Massachusetts Institute of Technology 12

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D11Mit12	c	143bp	C3HeB/FeJLe
	D11Mit12	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D11Mit12	a	137bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, LP/J, NON/ShiLt, SPRET/EiJ
	b	138bp	NOD/MrkTac
	c	141bp	BALB/cJ
	d	143bp	C3H/HeJ
	e	147bp	A/J, CAST/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24