About   Help   FAQ
D6Mit339 Primer Detail
Primers
  • Name
    D6Mit339
  • Primer 1 Sequence
    ATATCGATTGGCTTCTAAATGTCA
  • Primer 2 Sequence
    GCAGGTTGTCCTCTCACCTC
  • ID
    MGI:703848
  • Product Size
    118
  • Other IDs
    D6Mit339 (BROAD)
  • Note
    MIT assay: MTH1167
    Additional information: MIT STS Marker Data Files
Genes
D6Mit339 DNA Segment, Chr 6, Massachusetts Institute of Technology 339
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D6Mit339 a 94bp CAST/EiJ
b 100bp BALB/cJ, LP/J
c 110bp A/J, AKR/J, C3H/HeJ, DBA/2J, NOD/MrkTac
d 114bp SPRET/EiJ
e 116bp NON/ShiLt
f 118bp B6.Cg-Lepob/+, C57BL/6J
J:156851 Golas A, MGI Direct Data Submission. 2010;
Endonuclease Gene Allele Fragments Strains
D6Mit339 b lower C57BL/6J
s upper 129/Sv
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
J:156851 Golas A, Microsatellite differences on Chromosome 3, 6, 11 and 12 in C57BL/6J and 129/Sv strains and Mapping in CBXE RI line. MGI Direct Data Submission. 2010;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory