D4Mit152 Primer Detail MGI Mouse MGI:703837

D4Mit152 Primer Detail

Name

D4Mit152
Primer 1 Sequence

AAAGGAAAGAAAGAAAATTTTCACC
Primer 2 Sequence

TTTTCTCCATCCATTCAATGTG
ID

MGI:703837
Product Size

142
Other IDs

D4Mit152 (BROAD)
Note

MIT assay: MT1161
Additional information: MIT STS Marker Data Files

D4Mit152

DNA segment, Chr 4, Massachusetts Institute of Technology 152

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit152	a	133bp	SPRET/EiJ
	b	139bp	CAST/EiJ
	c	143bp	AKR/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
	d	155bp	LP/J
	e	161bp	A/J, BALB/cJ, DBA/2J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit152	a	161bp	A.CA/W, BALB/cW, DBA/2W
	D4Mit152	b	143bp	129/SvW, AKR/W, BN/aW, C3H/W, C57BL/6W, C57BL/10W, CBA/W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23