About   Help   FAQ
D4Mit158 Primer Detail
Primers
  • Name
    D4Mit158
  • Primer 1 Sequence
    CCTCATGTGGAGGCCATC
  • Primer 2 Sequence
    TTCAATTCTCAGAATCCTTGATAGG
  • ID
    MGI:703829
  • Product Size
    147
  • Other IDs
    D4Mit158 (BROAD)
  • Note
    MIT assay: MT1033
    Additional information: MIT STS Marker Data Files
Genes
D4Mit158 DNA segment, Chr 4, Massachusetts Institute of Technology 158
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D4Mit158 b larger C57BL/6J
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit158 a 100bp SPRET/EiJ
b 128bp CAST/EiJ
c 130bp BALB/cJ, C3H/HeJ, DBA/2J
d 144bp A/J
e 146bp AKR/J
f 148bp B6.Cg-Lepob/+, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory