D4Mit158 Primer Detail MGI Mouse MGI:703829

D4Mit158 Primer Detail

Name

D4Mit158
Primer 1 Sequence

CCTCATGTGGAGGCCATC
Primer 2 Sequence

TTCAATTCTCAGAATCCTTGATAGG
ID

MGI:703829
Product Size

147
Other IDs

D4Mit158 (BROAD)
Note

MIT assay: MT1033
Additional information: MIT STS Marker Data Files

D4Mit158

DNA segment, Chr 4, Massachusetts Institute of Technology 158

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit158	b	larger	C57BL/6J
	D4Mit158	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit158	a	100bp	SPRET/EiJ
	b	128bp	CAST/EiJ
	c	130bp	BALB/cJ, C3H/HeJ, DBA/2J
	d	144bp	A/J
	e	146bp	AKR/J
	f	148bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24