D4Mit33 Primer Detail MGI Mouse MGI:703821

D4Mit33 Primer Detail

Name

D4Mit33
Primer 1 Sequence

GGAGGTGTCAGGAGCCCT
Primer 2 Sequence

CTCCTGACTGAGGTACCAAACC
ID

MGI:703821
Product Size

126
Other IDs

D4Mit33 (BROAD)
Note

MIT assay: B333
Additional information: MIT STS Marker Data Files

D4Mit33

DNA segment, Chr 4, Massachusetts Institute of Technology 33

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D4Mit33	a	128bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J
	b	138bp	AKR/J, C3H/HeJ, NOD/MrkTac, NON/ShiLt, SPRET/EiJ
	c	142bp	CAST/EiJ
	d	144bp	DBA/2J, LP/J

J:68682 Li X, et al., Mamm Genome. 2001 Jan;12(1):13-6

Endonuclease	Gene	Allele	Fragments	Strains
	D4Mit33	a	smaller	C57BL/6ByJ
	D4Mit33	b	bigger	129P3/J

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:68682 Li X, et al., High-resolution genetic mapping of the saccharin preference locus (Sac) and the putative sweet taste receptor (T1R1) gene (Gpr70) to mouse distal Chromosome 4. Mamm Genome. 2001 Jan;12(1):13-6

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/14/2024 MGI 6.23