About   Help   FAQ
D4Mit33 Primer Detail
Primers
  • Name
    D4Mit33
  • Primer 1 Sequence
    GGAGGTGTCAGGAGCCCT
  • Primer 2 Sequence
    CTCCTGACTGAGGTACCAAACC
  • ID
    MGI:703821
  • Product Size
    126
  • Other IDs
    D4Mit33 (BROAD)
  • Note
    MIT assay: B333
    Additional information: MIT STS Marker Data Files
Genes
D4Mit33 DNA segment, Chr 4, Massachusetts Institute of Technology 33
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D4Mit33 a 128bp A/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J
b 138bp AKR/J, C3H/HeJ, NOD/MrkTac, NON/ShiLt, SPRET/EiJ
c 142bp CAST/EiJ
d 144bp DBA/2J, LP/J
J:68682 Li X, et al., Mamm Genome. 2001 Jan;12(1):13-6
Endonuclease Gene Allele Fragments Strains
D4Mit33 a smaller C57BL/6ByJ
b bigger 129P3/J
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:68682 Li X, et al., High-resolution genetic mapping of the saccharin preference locus (Sac) and the putative sweet taste receptor (T1R1) gene (Gpr70) to mouse distal Chromosome 4. Mamm Genome. 2001 Jan;12(1):13-6
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory