About   Help   FAQ
D19Mit110 Primer Detail
Primers
  • Name
    D19Mit110
  • Primer 1 Sequence
    TGTAATCAATGTATGTTAAACTTAGGC
  • Primer 2 Sequence
    TGAATTGGGTCTTTCCTTGG
  • ID
    MGI:703813
  • Product Size
    171
  • Other IDs
    D19Mit110 (BROAD)
  • Note
    MIT assay: MTH1581
    Additional information: MIT STS Marker Data Files
Genes
D19Mit110 DNA Segment, Chr 19, Massachusetts Institute of Technology 110
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit110 a 173bp 129P2/Ola, 129P3/J, 129T1/Sv-Dnd1Ter, 129X1/Sv
b 177bp 129X1/SvJ
c 173, 175bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit110 a 163bp C3H/HeJ, DBA/2J, LP/J
b 171bp AKR/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
c 175bp A/J
d 179bp SPRET/EiJ
e 195bp CAST/EiJ
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory