About   Help   FAQ
D19Mit111 Primer Detail
Primers
  • Name
    D19Mit111
  • Primer 1 Sequence
    TTTCCACAACTGCTCTATTTTATATTC
  • Primer 2 Sequence
    TACTAAATGGGCTCAGCGGT
  • ID
    MGI:703812
  • Product Size
    125
  • Other IDs
    D19Mit111 (BROAD)
  • Note
    MIT assay: MTH854
    Additional information: MIT STS Marker Data Files
Genes
D19Mit111 DNA Segment, Chr 19, Massachusetts Institute of Technology 111
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D19Mit111 a 128bp 129X1/Sv
f 122, 128bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit111 a 120bp NOD/MrkTac, NON/ShiLt
b 122bp A/J, BALB/cJ
c 124bp B6.Cg-Lepob/+, C57BL/6J
d 128bp AKR/J, C3H/HeJ, LP/J
e 130bp CAST/EiJ, DBA/2J
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D19Mit111 b 119bp C57BL/6JOlaHsd, C57BL/10
c 117bp 129P3/J, A/JOlaHsd, BALB/cJ, SJL/J
d 125bp AKR/OlaHsd, DBA/2J
h 123bp C3H/HeJ
p 99bp JF1, PWB
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/09/2025
MGI 6.24
The Jackson Laboratory