D19Mit111 Primer Detail MGI Mouse MGI:703812

D19Mit111 Primer Detail

Name

D19Mit111
Primer 1 Sequence

TTTCCACAACTGCTCTATTTTATATTC
Primer 2 Sequence

TACTAAATGGGCTCAGCGGT
ID

MGI:703812
Product Size

125
Other IDs

D19Mit111 (BROAD)
Note

MIT assay: MTH854
Additional information: MIT STS Marker Data Files

DNA Segment, Chr 19, Massachusetts Institute of Technology 111

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D19Mit111	a	128bp	129X1/Sv
Not Specified	D19Mit111	f	122, 128bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D19Mit111	a	120bp	NOD/MrkTac, NON/ShiLt
	b	122bp	A/J, BALB/cJ
	c	124bp	B6.Cg-Lep^ob/+, C57BL/6J
	d	128bp	AKR/J, C3H/HeJ, LP/J
	e	130bp	CAST/EiJ, DBA/2J

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D19Mit111	b	119bp	C57BL/6JOlaHsd, C57BL/10
	c	117bp	129P3/J, A/JOlaHsd, BALB/cJ, SJL/J
	d	125bp	AKR/OlaHsd, DBA/2J
	h	123bp	C3H/HeJ
	p	99bp	JF1, PWB

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/21/2024 MGI 6.23