About   Help   FAQ
D1Mit403 Primer Detail
Primers
  • Name
    D1Mit403
  • Primer 1 Sequence
    TATTGAGGGTGTGTTTTTATTTCTC
  • Primer 2 Sequence
    CTCCACGGGTCCCTGTATTC
  • ID
    MGI:703799
  • Product Size
    122
  • Other IDs
    D1Mit403 (BROAD)
  • Note
    MIT assay: MJ4758
    Additional information: MIT STS Marker Data Files
Genes
D1Mit403 DNA segment, Chr 1, Massachusetts Institute of Technology 403
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
Not Specified D1Mit403 c 147bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit403 a 125bp B6.Cg-Lepob/+, C57BL/6J
b 127bp AKR/J, DBA/2J
c 129bp NON/ShiLt
d 131bp A/J
e 147bp BALB/cJ, C3H/HeJ, LP/J, NOD/MrkTac
f 157bp SPRET/EiJ
g 195bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D1Mit403 c 233bp CBA/CaOlaHsd
s 235bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/21/2024
MGI 6.23
The Jackson Laboratory