D7Mit96 Primer Detail MGI Mouse MGI:703790

D7Mit96 Primer Detail

Name

D7Mit96
Primer 1 Sequence

TTCTTCTTGGGCTTTCCTCA
Primer 2 Sequence

AACATATGCCCTTGCTCACC
ID

MGI:703790
Product Size

76
Other IDs

D7Mit96 (BROAD)
Note

MIT assay: MPC1501
Additional information: MIT STS Marker Data Files

D7Mit96

DNA segment, Chr 7, Massachusetts Institute of Technology 96

J:43450 Haddad R, et al., Cancer Res. 1997 Oct 15;57(20):4615-23

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D7Mit96	a	larger	129/Sv
		b	smallest	C57BL/10
		c	smaller	C3H

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D7Mit96	a	78bp	B6.Cg-Lep^ob/+, C57BL/6J, NOD/MrkTac
	b	80bp	C3H/HeJ, DBA/2J
	c	94bp	SPRET/EiJ
	d	106bp	AKR/J, CAST/EiJ, LP/J
	e	108bp	A/J, BALB/cJ, NON/ShiLt

J:43450 Haddad R, et al., Genomic imprinting and Igf2 influence liver tumorigenesis and loss of heterozygosity in SV40 T antigen transgenic mice. Cancer Res. 1997 Oct 15;57(20):4615-23

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24