D14Mit5 Primer Detail MGI Mouse MGI:703789

D14Mit5 Primer Detail

Name

D14Mit5
Primer 1 Sequence

CACATGAACAGAGGGGCAG
Primer 2 Sequence

GTCATGAAGTGCCCACCTTT
ID

MGI:703789
Product Size

178
Other IDs

D14Mit5 (BROAD)
Note

MIT assay: M214
Additional information: MIT STS Marker Data Files

D14Mit5

DNA segment, Chr 14, Massachusetts Institute of Technology 5

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D14Mit5	a	largest	C57BL/6
		b	smaller	DBA/2
		c	smallest	JF1, MSM/Ms

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D14Mit5	a	156bp	SPRET/EiJ
	b	164bp	AKR/J, C3H/HeJ, DBA/2J
	c	178bp	A/J, B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
	d	182bp	CAST/EiJ

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D14Mit5	l	smaller	LG/J
	D14Mit5	s	larger	SM/J

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/28/2024 MGI 6.13