About   Help   FAQ
D7Mit19 Primer Detail
Primers
  • Name
    D7Mit19
  • Primer 1 Sequence
    GCTGCAGCTCTCTCTGGG
  • Primer 2 Sequence
    GATGGCTCTGATACAGCAAGC
  • ID
    MGI:703785
  • Product Size
    133
  • Other IDs
    D7Mit19 (BROAD)
  • Note
    MIT assay: d108
    Additional information: MIT STS Marker Data Files
Genes
D7Mit19 DNA segment, Chr 7, Massachusetts Institute of Technology 19
Polymorphisms
J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70
Endonuclease Gene Allele Fragments Strains
Not Specified D7Mit19 m 142bp MOLF/EiJ
s 134bp 129/Sv
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D7Mit19 a 126bp SPRET/EiJ
b 130bp CAST/EiJ
c 134bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
References
J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/09/2026
MGI 6.24
The Jackson Laboratory