About   Help   FAQ
D2Mit74 Primer Detail
Primers
  • Name
    D2Mit74
  • Primer 1 Sequence
    CCAAGCTTGCAGTTTGTTAGC
  • Primer 2 Sequence
    AGGTGTTATTGAGCCCTGTATAGC
  • ID
    MGI:703776
  • Product Size
    153
  • Other IDs
    D2Mit74 (BROAD)
  • Note
    MIT assay: B599
    Additional information: MIT STS Marker Data Files
Genes
D2Mit74 DNA segment, Chr 2, Massachusetts Institute of Technology 74
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D2Mit74 b smaller than f C57BL/6J
c 146bp C3HeB/FeJLe
f larger than c and b FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit74 a 124bp SPRET/EiJ
b 144bp B6.Cg-Lepob/+, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
c 146bp A/J, AKR/J, BALB/cJ, C3H/HeJ, CAST/EiJ, DBA/2J
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
09/30/2025
MGI 6.24
The Jackson Laboratory