About   Help   FAQ
D3Mit1 Primer Detail
Primers
  • Name
    D3Mit1
  • Primer 1 Sequence
    TGTGCACAGGGGTACATACA
  • Primer 2 Sequence
    TCATTTTCTTCCTCCCCCTC
  • ID
    MGI:703751
  • Product Size
    143
  • Note
    MIT assay: M28
Genes
D3Mit1 DNA segment, Chr 3, Massachusetts Institute of Technology 1
Polymorphisms
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D3Mit1 a largest JF1, MSM/Ms
b smaller C57BL/6, DBA/2
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit1 a 118bp CAST/EiJ
b 120bp A/J, AKR/J, C3H/HeJ, C57BL/6J, DBA/2J, NON/ShiLt
c 123bp BALB/cJ, NOD/MrkTac
d 132bp LP/J
e 134bp B6.Cg-Lepob/+
References
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory