About   Help   FAQ
D10Mit167 Primer Detail
Primers
  • Name
    D10Mit167
  • Primer 1 Sequence
    TGTGTAGGTATGTGTGTGCATAGG
  • Primer 2 Sequence
    GCACCTGGGAACAACACC
  • ID
    MGI:703735
  • Product Size
    97
  • Note
    MIT assay: MT2671
Genes
D10Mit167 DNA segment, Chr 10, Massachusetts Institute of Technology 167
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D10Mit167 a 94bp 129X1/Sv
f 122, 126bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D10Mit167 a 94bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, NON/ShiLt
b 116bp SPRET/EiJ
c 120bp BALB/cJ, C3H/HeJ, DBA/2J, LP/J
d 122bp A/J
e 126bp NOD/MrkTac
f 142bp CAST/EiJ
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
10/07/2025
MGI 6.24
The Jackson Laboratory