About   Help   FAQ
D17Mit198 Primer Detail
Primers
  • Name
    D17Mit198
  • Primer 1 Sequence
    TGCTTCTACCTCCCAAGGG
  • Primer 2 Sequence
    CCAACCTTTCAAGTCAGATGTG
  • ID
    MGI:703734
  • Product Size
    101
  • Other IDs
    D17Mit198 (BROAD)
  • Note
    MIT assay: MT5190
    Additional information: MIT STS Marker Data Files
Genes
D17Mit198 DNA segment, Chr 17, Massachusetts Institute of Technology 198
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D17Mit198 a 102bp B6.Cg-Lepob/+, C57BL/6J, NOD/MrkTac
b 110bp NON/ShiLt
c 112bp SPRET/EiJ
d 114bp BALB/cJ, LP/J
e 116bp A/J, AKR/J, C3H/HeJ, DBA/2J
f 132bp CAST/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D17Mit198 c 110bp CBA/CaOlaHsd
s 98bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory