D3Mit42 Primer Detail MGI Mouse MGI:703723

D3Mit42 Primer Detail

Name

D3Mit42
Primer 1 Sequence

TGACCTCCAGAGAGTCTTCCA
Primer 2 Sequence

TAAGCAGCTGAGACTCAAGTGG
ID

MGI:703723
Product Size

153
Other IDs

D3Mit42 (BROAD)
Note

MIT assay: B344
Additional information: MIT STS Marker Data Files

D3Mit42

DNA segment, Chr 3, Massachusetts Institute of Technology 42

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit42	c	158bp	C3HeB/FeJLe
	D3Mit42	f	larger	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit42	a	144bp	SPRET/EiJ
	b	146bp	DBA/2J
	c	154bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, LP/J, NOD/MrkTac, NON/ShiLt
	d	158bp	A/J, BALB/cJ, C3H/HeJ
	e	176bp	CAST/EiJ

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24