About   Help   FAQ
D3Mit46 Primer Detail
Primers
  • Name
    D3Mit46
  • Primer 1 Sequence
    ATCCCCCACCCAACTCTAAC
  • Primer 2 Sequence
    TTCCCCAGGGAAATCTCTCT
  • ID
    MGI:703720
  • Product Size
    162
  • Other IDs
    D3Mit46 (BROAD)
  • Note
    MIT assay: D534
    Additional information: MIT STS Marker Data Files
Genes
D3Mit46 DNA segment, Chr 3, Massachusetts Institute of Technology 46
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D3Mit46 b not given C57BL/6J
c 178bp C3HeB/FeJLe
f smallest FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit46 a 152bp AKR/J
b 158bp NON/ShiLt
c 160bp DBA/2J
d 162bp LP/J, NOD/MrkTac
e 164bp BALB/cJ
f 166bp B6.Cg-Lepob/+, C57BL/6J
g 172bp A/J, C3H/HeJ
h 190bp CAST/EiJ
i 194bp SPRET/EiJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D3Mit46 c not given C58/J
f not given FVB/NJ
i smaller I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D3Mit46 c 195bp CBA/CaOlaHsd
s 161bp SWR/OlaHsd
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/09/2026
MGI 6.24
The Jackson Laboratory