About   Help   FAQ
D3Mit45 Primer Detail
Primers
  • Name
    D3Mit45
  • Primer 1 Sequence
    CCATGATGTAAAGCCCAACC
  • Primer 2 Sequence
    TTAACACCCCAATGTAGTGGTG
  • ID
    MGI:703719
  • Product Size
    146
  • Other IDs
    D3Mit45 (BROAD)
  • Note
    MIT assay: B410
    Additional information: MIT STS Marker Data Files
Genes
D3Mit45 DNA segment, Chr 3, Massachusetts Institute of Technology 45
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit45 a 126bp SPRET/EiJ
b 130bp CAST/EiJ
c 134bp A/J, BALB/cJ, C3H/HeJ, LP/J
d 140bp AKR/J
e 144bp C57BL/6J, NON/ShiLt
f 146bp DBA/2J, NOD/MrkTac
g 148bp B6.Cg-Lepob/+
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D3Mit45 c not given C58/J
f not given FVB/NJ
i smaller I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D3Mit45 c 133bp CBA/CaOlaHsd
s 132bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/06/2026
MGI 6.24
The Jackson Laboratory