About   Help   FAQ
D3Mit44 Primer Detail
Primers
  • Name
    D3Mit44
  • Primer 1 Sequence
    CCTGACTCATTTATTTAACTCCCC
  • Primer 2 Sequence
    CCCTATCACATAGGGCAACC
  • ID
    MGI:703718
  • Product Size
    143
  • Other IDs
    D3Mit44 (BROAD)
  • Note
    MIT assay: B439
    Additional information: MIT STS Marker Data Files
Genes
D3Mit44 DNA segment, Chr 3, Massachusetts Institute of Technology 44
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D3Mit44 a 134bp 129X1/Sv
f 138, 140bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit44 a 124bp SPRET/EiJ
b 128bp CAST/EiJ
c 134bp A/J, BALB/cJ, C3H/HeJ, LP/J
d 140bp AKR/J
e 144bp NON/ShiLt
f 146bp B6.Cg-Lepob/+, C57BL/6J
g 148bp DBA/2J, NOD/MrkTac
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D3Mit44 a 135bp AKR/OlaHsd
b 141bp C57BL/6JOlaHsd, C57BL/10
c 129bp 129P3/J, A/JOlaHsd, BALB/cJ, C3H/HeJ, SJL/J
d 143bp DBA/2J
j 127bp JF1
p 125bp PWB
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D3Mit44 l larger LG/J
s smaller SM/J
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory