About   Help   FAQ
D3Mit49 Primer Detail
Primers
  • Name
    D3Mit49
  • Primer 1 Sequence
    CTTTTCTCGCCCCACTTTC
  • Primer 2 Sequence
    TCCTTTTAGTTTTTGATCCTCTGG
  • ID
    MGI:703717
  • Product Size
    132
  • Other IDs
    D3Mit49 (BROAD)
  • Note
    MIT assay: D567
    Additional information: MIT STS Marker Data Files
Genes
D3Mit49 DNA segment, Chr 3, Massachusetts Institute of Technology 49
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D3Mit49 b larger C57BL/6J
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit49 a 108bp CAST/EiJ
b 110bp C3H/HeJ, NON/ShiLt
c 128bp B6.Cg-Lepob/+, C57BL/6J, LP/J
d 148bp BALB/cJ, DBA/2J
J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12
Endonuclease Gene Allele Fragments Strains
D3Mit49 l smaller LG/J
s larger SM/J
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D3Mit49 a 148bp BALB/cW, DBA/2W
b 128bp 129/SvW, C57BL/6W, C57BL/10W
c 110bp A.CA/W, AKR/W, BN/aW, C3H/W, CBA/W
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory