D3Mit49 Primer Detail MGI Mouse MGI:703717

D3Mit49 Primer Detail

Name

D3Mit49
Primer 1 Sequence

CTTTTCTCGCCCCACTTTC
Primer 2 Sequence

TCCTTTTAGTTTTTGATCCTCTGG
ID

MGI:703717
Product Size

132
Other IDs

D3Mit49 (BROAD)
Note

MIT assay: D567
Additional information: MIT STS Marker Data Files

D3Mit49

DNA segment, Chr 3, Massachusetts Institute of Technology 49

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit49	b	larger	C57BL/6J
	D3Mit49	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit49	a	108bp	CAST/EiJ
	b	110bp	C3H/HeJ, NON/ShiLt
	c	128bp	B6.Cg-Lep^ob/+, C57BL/6J, LP/J
	d	148bp	BALB/cJ, DBA/2J

J:62610 Cheverud JM, et al., Mamm Genome. 2001 Jan;12(1):3-12

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit49	l	smaller	LG/J
	D3Mit49	s	larger	SM/J

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D3Mit49	a	148bp	BALB/cW, DBA/2W
	b	128bp	129/SvW, C57BL/6W, C57BL/10W
	c	110bp	A.CA/W, AKR/W, BN/aW, C3H/W, CBA/W

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:62610 Cheverud JM, et al., Genetic architecture of adiposity in the cross of LG/J and SM/J inbred mice. Mamm Genome. 2001 Jan;12(1):3-12

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24