About   Help   FAQ
D1Mit45 Primer Detail
Primers
  • Name
    D1Mit45
  • Primer 1 Sequence
    TGCACCTGACTGAGAATTGTG
  • Primer 2 Sequence
    CACGTGTGCTGTGGTGGT
  • ID
    MGI:703654
  • Product Size
    169
  • Other IDs
    D1Mit45 (BROAD)
  • Note
    MIT assay: A868
    Additional information: MIT STS Marker Data Files
Genes
D1Mit45 DNA segment, Chr 1, Massachusetts Institute of Technology 45
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit45 a 170bp C3H/HeJ, NON/ShiLt
b 172bp AKR/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, NOD/MrkTac
c 176bp CAST/EiJ
d 180bp A/J, DBA/2J, LP/J, SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D1Mit45 c 163bp CBA/CaOlaHsd
s 186bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;
Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support. 		last database update
05/21/2024
MGI 6.23 		The Jackson Laboratory