D1Mit46 Primer Detail MGI Mouse MGI:703651

D1Mit46 Primer Detail

Name

D1Mit46
Primer 1 Sequence

AGTCAGTCAGGGCTACATGATG
Primer 2 Sequence

CACGGGTGCTCTATTTGGAA
ID

MGI:703651
Product Size

253
Other IDs

D1Mit46 (BROAD)
Note

MIT assay: B219
Additional information: MIT STS Marker Data Files

D1Mit46

DNA segment, Chr 1, Massachusetts Institute of Technology 46

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit46	a	256bp	B6.Cg-Lep^ob/+, BALB/cJ, C57BL/6J, NON/ShiLt
	b	264bp	DBA/2J, LP/J
	c	276bp	A/J, C3H/HeJ
	d	278bp	NOD/MrkTac
	e	296bp	AKR/J
	f	320bp	CAST/EiJ
	g	410bp	SPRET/EiJ

J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3

Gene	Allele	Fragments	Strains
D1Mit46	c	not given	C58/J
	f	not given	FVB/NJ
	i	larger	I/LnJ

J:67963 Iraqi F, MGI Direct Data Submission. 2001;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit46	c	258bp	CBA/CaOlaHsd
	D1Mit46	s	264bp	SWR/OlaHsd

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Gene	Allele	Fragments	Strains
D1Mit46	a	296bp	AKR/W
	b	276bp	A.CA/W, BN/aW, C3H/W
	c	264bp	129/SvW, DBA/2W
	d	256bp	BALB/cW, C57BL/6W, C57BL/10W, CBA/W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3

J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23