About   Help   FAQ
D1Mit46 Primer Detail
Primers
  • Name
    D1Mit46
  • Primer 1 Sequence
    AGTCAGTCAGGGCTACATGATG
  • Primer 2 Sequence
    CACGGGTGCTCTATTTGGAA
  • ID
    MGI:703651
  • Product Size
    253
  • Other IDs
    D1Mit46 (BROAD)
  • Note
    MIT assay: B219
    Additional information: MIT STS Marker Data Files
Genes
D1Mit46 DNA segment, Chr 1, Massachusetts Institute of Technology 46
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit46 a 256bp B6.Cg-Lepob/+, BALB/cJ, C57BL/6J, NON/ShiLt
b 264bp DBA/2J, LP/J
c 276bp A/J, C3H/HeJ
d 278bp NOD/MrkTac
e 296bp AKR/J
f 320bp CAST/EiJ
g 410bp SPRET/EiJ
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D1Mit46 c not given C58/J
f not given FVB/NJ
i larger I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D1Mit46 c 258bp CBA/CaOlaHsd
s 264bp SWR/OlaHsd
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D1Mit46 a 296bp AKR/W
b 276bp A.CA/W, BN/aW, C3H/W
c 264bp 129/SvW, DBA/2W
d 256bp BALB/cW, C57BL/6W, C57BL/10W, CBA/W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory