About   Help   FAQ
D1Mit42 Primer Detail
Primers
  • Name
    D1Mit42
  • Primer 1 Sequence
    CTCAGGCACCATTCTAAACATG
  • Primer 2 Sequence
    ATAGGGCAAAAAACATTCTTGC
  • ID
    MGI:703649
  • Product Size
    253
  • Other IDs
    D1Mit42 (BROAD)
  • Note
    MIT assay: A664
    Additional information: MIT STS Marker Data Files
Genes
D1Mit42 DNA segment, Chr 1, Massachusetts Institute of Technology 42
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D1Mit42 a 236bp DBA/2J, LP/J, SPRET/EiJ
b 254bp B6.Cg-Lepob/+
c 256bp A/J, AKR/J, BALB/cJ, C3H/HeJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
d 272bp CAST/EiJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D1Mit42 a 200bp 129/SvW, A.CA/W, AKR/W, BALB/cW, BN/aW, C3H/W, CBA/W, DBA/2W
b 180bp C57BL/6W, C57BL/10W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory