D1Mit42 Primer Detail MGI Mouse MGI:703649

D1Mit42 Primer Detail

Name

D1Mit42
Primer 1 Sequence

CTCAGGCACCATTCTAAACATG
Primer 2 Sequence

ATAGGGCAAAAAACATTCTTGC
ID

MGI:703649
Product Size

253
Other IDs

D1Mit42 (BROAD)
Note

MIT assay: A664
Additional information: MIT STS Marker Data Files

D1Mit42

DNA segment, Chr 1, Massachusetts Institute of Technology 42

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D1Mit42	a	236bp	DBA/2J, LP/J, SPRET/EiJ
	b	254bp	B6.Cg-Lep^ob/+
	c	256bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, C57BL/6J, NOD/MrkTac, NON/ShiLt
	d	272bp	CAST/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D1Mit42	a	200bp	129/SvW, A.CA/W, AKR/W, BALB/cW, BN/aW, C3H/W, CBA/W, DBA/2W
	D1Mit42	b	180bp	C57BL/6W, C57BL/10W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23