About   Help   FAQ
D9Mit89 Primer Detail
Primers
  • Name
    D9Mit89
  • Primer 1 Sequence
    CACATACAAGGATATACATACACAGGC
  • Primer 2 Sequence
    TCACAGGAGGTGGCAGAAAT
  • ID
    MGI:703636
  • Product Size
    145
  • Other IDs
    D9Mit89 (BROAD)
  • Note
    MIT assay: MPC2566
    Additional information: MIT STS Marker Data Files
Genes
D9Mit89 DNA segment, Chr 9, Massachusetts Institute of Technology 89
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit89 a 128bp SPRET/EiJ
b 142bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, NOD/MrkTac
c 148bp A/J, BALB/cJ, C3H/HeJ, NON/ShiLt
d 170bp LP/J
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D9Mit89 d 139bp 129P3/J, A/JOlaHsd, AKR/OlaHsd, BALB/cJ, C3H/HeJ, C57BL/6JOlaHsd, C57BL/10, DBA/2J
j 143bp JF1
l 149bp SJL/J
p 127bp PWB
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D9Mit89 a 160bp BN/aW
b 148bp 129/SvW, A.CA/W, AKR/W, BALB/cW, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory