D9Mit89 Primer Detail MGI Mouse MGI:703636

D9Mit89 Primer Detail

Name

D9Mit89
Primer 1 Sequence

CACATACAAGGATATACATACACAGGC
Primer 2 Sequence

TCACAGGAGGTGGCAGAAAT
ID

MGI:703636
Product Size

145
Other IDs

D9Mit89 (BROAD)
Note

MIT assay: MPC2566
Additional information: MIT STS Marker Data Files

D9Mit89

DNA segment, Chr 9, Massachusetts Institute of Technology 89

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D9Mit89	a	128bp	SPRET/EiJ
	b	142bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, NOD/MrkTac
	c	148bp	A/J, BALB/cJ, C3H/HeJ, NON/ShiLt
	d	170bp	LP/J

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D9Mit89	d	139bp	129P3/J, A/JOlaHsd, AKR/OlaHsd, BALB/cJ, C3H/HeJ, C57BL/6JOlaHsd, C57BL/10, DBA/2J
	j	143bp	JF1
	l	149bp	SJL/J
	p	127bp	PWB

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D9Mit89	a	160bp	BN/aW
	D9Mit89	b	148bp	129/SvW, A.CA/W, AKR/W, BALB/cW, C3H/W, C57BL/6W, C57BL/10W, CBA/W, DBA/2W

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 03/25/2025 MGI 6.24