D12Mit114 Primer Detail MGI Mouse MGI:703610

D12Mit114 Primer Detail

Name

D12Mit114
Primer 1 Sequence

TTGACCTTGAACTTGTGACCC
Primer 2 Sequence

GTTTTCTCCAAATCACTGTCACC
ID

MGI:703610
Product Size

144
Other IDs

D12Mit114 (BROAD)
Note

MIT assay: MMH331
Additional information: MIT STS Marker Data Files

DNA segment, Chr 12, Massachusetts Institute of Technology 114

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Endonuclease	Gene	Allele	Fragments	Strains
	D12Mit114	b	larger	C57BL/6J
	D12Mit114	f	smaller	FVB/N

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D12Mit114	a	126bp	A/J, BALB/cJ, C3H/HeJ, CAST/EiJ, DBA/2J, NON/ShiLt
	b	142bp	SPRET/EiJ
	c	146bp	AKR/J, B6.Cg-Lep^ob/+, C57BL/6J, LP/J, NOD/MrkTac

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23