About   Help   FAQ
D12Mit114 Primer Detail
Primers
  • Name
    D12Mit114
  • Primer 1 Sequence
    TTGACCTTGAACTTGTGACCC
  • Primer 2 Sequence
    GTTTTCTCCAAATCACTGTCACC
  • ID
    MGI:703610
  • Product Size
    144
  • Other IDs
    D12Mit114 (BROAD)
  • Note
    MIT assay: MMH331
    Additional information: MIT STS Marker Data Files
Genes
D12Mit114 DNA segment, Chr 12, Massachusetts Institute of Technology 114
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D12Mit114 b larger C57BL/6J
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D12Mit114 a 126bp A/J, BALB/cJ, C3H/HeJ, CAST/EiJ, DBA/2J, NON/ShiLt
b 142bp SPRET/EiJ
c 146bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, LP/J, NOD/MrkTac
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory