About   Help   FAQ
DXMit6 Primer Detail
Primers
  • Name
    DXMit6
  • Primer 1 Sequence
    ACCATTCAAATTGGCAAGGC
  • Primer 2 Sequence
    GTGGCTCGAGTTGTTTGCAG
  • ID
    MGI:703595
  • Product Size
    207
  • Other IDs
    DXMit6 (BROAD)
  • Note
    MIT assay: D28
    Additional information: MIT STS Marker Data Files
  • Synonyms
    DXMit6-pA, DXMit6-pB
Genes
DXMit6 DNA segment, Chr X, Massachusetts Institute of Technology 6
Polymorphisms
J:4132 Angel TA, et al., Mamm Genome. 1993;4(3):171-6
Endonuclease Gene Allele Fragments Strains
DXMit6 b 208bp C57BL/6J-Aw-J/J
c 204bp M. m. castaneus
h 208bp C3H
s not given M. spretus
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
DXMit6 a 204bp CAST/EiJ, SPRET/EiJ
b 208bp A/J, AKR/J, B6.Cg-Lepob/+, BALB/cJ, C3H/HeJ, C57BL/6J, DBA/2J, LP/J
References
J:4132 Angel TA, et al., Genetic mapping of the X-linked dominant mutations striated (Str) and bare patches (Bpa) to a 600-kb region of the mouse X chromosome: implications for mapping human disorders in Xq28. Mamm Genome. 1993;4(3):171-6
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory