D6Mit289 Primer Detail MGI Mouse MGI:703584

D6Mit289 Primer Detail

Name

D6Mit289
Primer 1 Sequence

TGGAGATCCACGGCATTG
Primer 2 Sequence

CTAGATTGAAGAATTCCTGGACC
ID

MGI:703584
Product Size

135
Other IDs

D6Mit289 (BROAD)
Note

MIT assay: MTH330
Additional information: MIT STS Marker Data Files

D6Mit289

DNA segment, Chr 6, Massachusetts Institute of Technology 289

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit289	a	116bp	SPRET/EiJ
	b	128bp	NOD/MrkTac
	c	134bp	B6.Cg-Lep^ob/+, C57BL/6J, NON/ShiLt
	d	138bp	AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J
	e	140bp	A/J
	f	172bp	CAST/EiJ

J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87

Gene	Allele	Fragments	Strains
D6Mit289	b	136bp	129P3/J, C57BL/6JOlaHsd, C57BL/10
	d	140bp	AKR/OlaHsd, BALB/cJ, C3H/HeJ, DBA/2J, PWB
	j	140bp	JF1
	w	142bp	A/JOlaHsd, SJL/J

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24