About   Help   FAQ
D5Mit93 Primer Detail
Primers
  • Name
    D5Mit93
  • Primer 1 Sequence
    TGCTCTTCCAGAAGACCCAA
  • Primer 2 Sequence
    TGGACTACTGTATTTCACACTTGC
  • ID
    MGI:703555
  • Product Size
    193
  • Other IDs
    D5Mit93 (BROAD)
  • Note
    MIT assay: MPC843
    Additional information: MIT STS Marker Data Files
Genes
D5Mit93 DNA segment, Chr 5, Massachusetts Institute of Technology 93
Polymorphisms
J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9
Endonuclease Gene Allele Fragments Strains
D5Mit93 c 194bp C3HeB/FeJLe
f smaller FVB/N
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit93 a 146bp SPRET/EiJ
b 170bp DBA/2J, LP/J
c 188bp NON/ShiLt
d 190bp A/J, B6.Cg-Lepob/+, BALB/cJ, C57BL/6J
e 192bp AKR/J, NOD/MrkTac
f 194bp C3H/HeJ
g 198bp CAST/EiJ
References
J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/20/2026
MGI 6.24
The Jackson Laboratory