About   Help   FAQ
D5Mit95 Primer Detail
Primers
  • Name
    D5Mit95
  • Primer 1 Sequence
    TGTTCTTGTCCATGTCTGATCC
  • Primer 2 Sequence
    AACCAAAGCATGAAACAGCC
  • ID
    MGI:703549
  • Product Size
    114
  • Other IDs
    D5Mit95 (BROAD)
  • Note
    MIT assay: MPC1471
    Additional information: MIT STS Marker Data Files
Genes
D5Mit95 DNA segment, Chr 5, Massachusetts Institute of Technology 95
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D5Mit95 a 90bp SPRET/EiJ
b 92bp CAST/EiJ
c 116bp B6.Cg-Lepob/+, C57BL/6J
d 130bp AKR/J, DBA/2J, NOD/MrkTac
e 132bp A/J, BALB/cJ, LP/J, NON/ShiLt
f 134bp C3H/HeJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D5Mit95 c 130bp CBA/CaOlaHsd
s 118bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory