About   Help   FAQ
D19Mit56 Primer Detail
Primers
  • Name
    D19Mit56
  • Primer 1 Sequence
    CTGAATGTGTATGTGTGCAAGTATG
  • Primer 2 Sequence
    ATTATGAATTCAAGACTAGCCTAGGA
  • ID
    MGI:703533
  • Product Size
    135
  • Other IDs
    D19Mit56 (BROAD)
  • Note
    MIT assay: MT213
    Additional information: MIT STS Marker Data Files
Genes
D19Mit56 DNA segment, Chr 19, Massachusetts Institute of Technology 56
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D19Mit56 a 130bp A/J, BALB/cJ, C3H/HeJ
b 132bp CAST/EiJ
c 138bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac
J:57937 Schalkwyk LC, et al., Genome Res. 1999 Sep;9(9):878-87
Endonuclease Gene Allele Fragments Strains
D19Mit56 b 121bp C57BL/6JOlaHsd
c 113bp A/JOlaHsd, BALB/cJ, C3H/HeJ
d 123bp 129P3/J, AKR/OlaHsd, C57BL/10, DBA/2J, SJL/J
j 131bp JF1
p 125bp PWB
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:57937 Schalkwyk LC, et al., Panel of microsatellite markers for whole-genome scans and radiation hybrid mapping and a mouse family tree. Genome Res. 1999 Sep;9(9):878-87
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/13/2026
MGI 6.24
The Jackson Laboratory