About   Help   FAQ
D9Mit81 Primer Detail
Primers
  • Name
    D9Mit81
  • Primer 1 Sequence
    TGGTGTGTGGTTTTTGAAATG
  • Primer 2 Sequence
    CCTGTGGAAGAAGTGGGAAA
  • ID
    MGI:703518
  • Product Size
    165
  • Other IDs
    D9Mit81 (BROAD)
  • Note
    MIT assay: MPC1509
    Additional information: MIT STS Marker Data Files
Genes
D9Mit81 DNA segment, Chr 9, Massachusetts Institute of Technology 81
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D9Mit81 a 168bp AKR/J, B6.Cg-Lepob/+, C57BL/6J, DBA/2J, LP/J, NOD/MrkTac
b 170bp SPRET/EiJ
c 176bp CAST/EiJ
d 178bp NON/ShiLt
e 182bp A/J, BALB/cJ, C3H/HeJ
J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;
Endonuclease Gene Allele Fragments Strains
D9Mit81 a 182bp A.CA/W, BALB/cW, C3H/W
b 168bp 129/SvW, AKR/W, BN/aW, C57BL/6W, C57BL/10W, CBA/W, DBA/2W
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
05/26/2026
MGI 6.24
The Jackson Laboratory