D16Mit50 Primer Detail MGI Mouse MGI:703514

D16Mit50 Primer Detail

Name

D16Mit50
Primer 1 Sequence

CACACAGAATCTGCTGAAATCC
Primer 2 Sequence

CAATGAATGTGTTTATGTTGATGA
ID

MGI:703514
Product Size

130
Other IDs

D16Mit50 (BROAD)
Note

MIT assay: MPC495
Additional information: MIT STS Marker Data Files

D16Mit50

DNA segment, Chr 16, Massachusetts Institute of Technology 50

J:41370 Neuhaus IM, et al., Mamm Genome. 1997 Jul;8(7):506-9

Gene	Allele	Fragments	Strains
D16Mit50	b	larger than f	C57BL/6J
	c	132bp	C3HeB/FeJLe
	f	smaller	FVB/N

J:48980 Matin A, et al., Mamm Genome. 1998 Aug;9(8):668-70

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D16Mit50	m	159bp	MOLF/EiJ
Not Specified	D16Mit50	s	127bp	129/Sv

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit50	a	104bp	SPRET/EiJ
	b	112bp	A/J, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
	c	132bp	AKR/J, B6.Cg-Lep^ob/+, BALB/cJ, C3H/HeJ, C57BL/6J
	d	134bp	CAST/EiJ

J:78299 Wirth-Dzieciolowska E, et al., MGI Direct Data Submission. 2002 Aug;

Endonuclease	Gene	Allele	Fragments	Strains
	D16Mit50	a	132bp	129/SvW, AKR/W, BALB/cW, C3H/W, C57BL/6W, C57BL/10W, CBA/W
	D16Mit50	b	112bp	A.CA/W, BN/aW, DBA/2W

J:90435 Golas A, et al., MGI Direct Data Submission. 2004;

Endonuclease	Gene	Allele	Fragments	Strains
	D16Mit50	c	larger	CBA/Kw
	D16Mit50	e	smaller	KE

J:41370 Neuhaus IM, et al., Microsatellite DNA variants between the FVB/N and C3HeB/FeJLe and C57BL/6J mouse strains. Mamm Genome. 1997 Jul;8(7):506-9

J:48980 Matin A, et al., Simple sequence length polymorphisms (SSLPs) that distinguish MOLF/Ei and 129/Sv inbred strains of laboratory mice. Mamm Genome. 1998 Aug;9(8):668-70

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:78299 Wirth-Dzieciolowska E, et al., The genetic profiles basis of 215 microsatellite markers and 2 genetic loci for various inbred strains of mice. MGI Direct Data Submission. 2002 Aug;

J:90435 Golas A, et al., Mapping of mouse Chromosome 4, 10, 12, 13, 15, 16, 17, 18, 19, X, STS markers in CBXE RI strains. MGI Direct Data Submission. 2004;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23