About   Help   FAQ
D16Mit57 Primer Detail
Primers
  • Name
    D16Mit57
  • Primer 1 Sequence
    AAAAAATTTTAAACCATGTGAATGT
  • Primer 2 Sequence
    TGAAGTTTATTATGAGTTGAATCATGC
  • ID
    MGI:703509
  • Product Size
    112
  • Other IDs
    D16Mit57 (BROAD)
  • Note
    MIT assay: MPC716
    Additional information: MIT STS Marker Data Files
Genes
D16Mit57 DNA segment, Chr 16, Massachusetts Institute of Technology 57
Polymorphisms
J:50545 Augustin M, et al., Mamm Genome. 1998 Nov;9(11):899-902
Endonuclease Gene Allele Fragments Strains
D16Mit57 b 0.111kb C57BL/6J
s 0.135kb SEG/1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D16Mit57 a 93bp A/J, BALB/cJ
b 95bp AKR/J
c 107bp NOD/MrkTac, NON/ShiLt
d 111bp C3H/HeJ, C57BL/6J, DBA/2J
e 113bp B6.Cg-Lepob/+, LP/J
f 133bp CAST/EiJ
g 135bp SPRET/EiJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D16Mit57 c 147bp CBA/CaOlaHsd
s 130bp SWR/OlaHsd
References
J:50545 Augustin M, et al., Cloning and chromosomal mapping of the human p53-related KET gene to chromosome 3q27 and its murine homolog Ket to mouse chromosome 16. Mamm Genome. 1998 Nov;9(11):899-902
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/31/2026
MGI 6.24
The Jackson Laboratory