About   Help   FAQ
D16Mit58 Primer Detail
Primers
  • Name
    D16Mit58
  • Primer 1 Sequence
    TCTTTTTTCATTGTTGTTATACACACA
  • Primer 2 Sequence
    GGAACAAAAAACACGTGGCT
  • ID
    MGI:703506
  • Product Size
    158
  • Other IDs
    D16Mit58 (BROAD)
  • Note
    MIT assay: MPC713
    Additional information: MIT STS Marker Data Files
Genes
D16Mit58 DNA segment, Chr 16, Massachusetts Institute of Technology 58
Polymorphisms
J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2
Endonuclease Gene Allele Fragments Strains
Not Specified D16Mit58 a 157bp 129P2/Ola, 129P3/J, 129T1/Sv-Dnd1Ter, 129X1/Sv
b 151bp 129X1/SvJ
c 153bp CD-1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D16Mit58 a 135bp CAST/EiJ
b 145bp AKR/J
c 147bp A/J, BALB/cJ, NON/ShiLt
d 153bp C3H/HeJ, DBA/2J, LP/J
e 157bp NOD/MrkTac
f 159bp B6.Cg-Lepob/+, C57BL/6J
References
J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory