D16Mit58 Primer Detail MGI Mouse MGI:703506

D16Mit58 Primer Detail

Name

D16Mit58
Primer 1 Sequence

TCTTTTTTCATTGTTGTTATACACACA
Primer 2 Sequence

GGAACAAAAAACACGTGGCT
ID

MGI:703506
Product Size

158
Other IDs

D16Mit58 (BROAD)
Note

MIT assay: MPC713
Additional information: MIT STS Marker Data Files

D16Mit58

DNA segment, Chr 16, Massachusetts Institute of Technology 58

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D16Mit58	a	157bp	129P2/Ola, 129P3/J, 129T1/Sv-Dnd1^Ter, 129X1/Sv
		b	151bp	129X1/SvJ
		c	153bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D16Mit58	a	135bp	CAST/EiJ
	b	145bp	AKR/J
	c	147bp	A/J, BALB/cJ, NON/ShiLt
	d	153bp	C3H/HeJ, DBA/2J, LP/J
	e	157bp	NOD/MrkTac
	f	159bp	B6.Cg-Lep^ob/+, C57BL/6J

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 12/30/2025 MGI 6.24