About   Help   FAQ
D8Mit113 Primer Detail
Primers
  • Name
    D8Mit113
  • Primer 1 Sequence
    GGTCACATAATAAGAAAGCCCG
  • Primer 2 Sequence
    AACCCGTTAGGAGGACCG
  • ID
    MGI:703502
  • Product Size
    138
  • Other IDs
    D8Mit113 (BROAD)
  • Note
    MIT assay: MPC2649
    Additional information: MIT STS Marker Data Files
Genes
D8Mit113 DNA segment, Chr 8, Massachusetts Institute of Technology 113
Polymorphisms
J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61
Endonuclease Gene Allele Fragments Strains
Not Specified D8Mit113 b 0.138kb C57BL/6
c 0.160kb B10.BR-H2k, B10.D2-H2d, BALB.K-H2k, BALB/cAnNCr, BALB/cByJ, BALB/cJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D8Mit113 a 130bp SPRET/EiJ
b 138bp B6.Cg-Lepob/+, C57BL/6J
c 160bp A/J, AKR/J, BALB/cJ, C3H/HeJ, CAST/EiJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
References
J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
01/28/2026
MGI 6.24
The Jackson Laboratory