D6Mit373 Primer Detail MGI Mouse MGI:703473

D6Mit373 Primer Detail

Name

D6Mit373
Primer 1 Sequence

TTCTGGGGTGAGAGGCAG
Primer 2 Sequence

AGAACATTGACAAAAAGTGATTGTG
ID

MGI:703473
Product Size

106
Other IDs

D6Mit373 (BROAD)
Note

MIT assay: MTH2617
Additional information: MIT STS Marker Data Files

D6Mit373

DNA segment, Chr 6, Massachusetts Institute of Technology 373

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D6Mit373	a	120bp	129X1/Sv
Not Specified	D6Mit373	f	120, 126bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D6Mit373	a	88bp	CAST/EiJ, SPRET/EiJ
	b	106bp	AKR/J, B6.Cg-Lep^ob/+, C3H/HeJ, C57BL/6J, DBA/2J, NON/ShiLt
	c	120bp	A/J, BALB/cJ
	d	122bp	NOD/MrkTac
	e	126bp	LP/J

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 10/07/2025 MGI 6.24