About   Help   FAQ
D2Mit62 Primer Detail
Primers
  • Name
    D2Mit62
  • Primer 1 Sequence
    GGATACCGTTTGGAAAGTAAACC
  • Primer 2 Sequence
    GCAAGAAGCACAGGAGGC
  • ID
    MGI:703465
  • Product Size
    145
  • Other IDs
    D2Mit62 (BROAD)
  • Note
    MIT assay: D594
    Additional information: MIT STS Marker Data Files
Genes
D2Mit62 DNA segment, Chr 2, Massachusetts Institute of Technology 62
Polymorphisms
J:39615 Panoutsakopoulou V, et al., Mamm Genome. 1997 May;8(5):357-61
Endonuclease Gene Allele Fragments Strains
Not Specified D2Mit62 a <0.146kb BALB/cByJ
b 0.162kb B10.BR-H2k, B10.D2-H2d, C57BL/6
c 0.146kb BALB.K-H2k, BALB/cAnNCr, BALB/cJ
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D2Mit62 a 146bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, LP/J, NOD/MrkTac, NON/ShiLt
b 160bp CAST/EiJ
c 162bp B6.Cg-Lepob/+, C57BL/6J
d 168bp SPRET/EiJ
References
J:39615 Panoutsakopoulou V, et al., Microsatellite typing of CXB recombinant inbred and parental mouse strains. Mamm Genome. 1997 May;8(5):357-61
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
12/30/2025
MGI 6.24
The Jackson Laboratory