About   Help   FAQ
D14Mit141 Primer Detail
Primers
  • Name
    D14Mit141
  • Primer 1 Sequence
    CCAGCATTCCGAAGTCATTT
  • Primer 2 Sequence
    AGGGAAAGAAGACAGCACGA
  • ID
    MGI:703444
  • Product Size
    139
  • Other IDs
    D14Mit141 (BROAD)
  • Note
    MIT assay: MT1521
    Additional information: MIT STS Marker Data Files
Genes
D14Mit141 DNA segment, Chr 14, Massachusetts Institute of Technology 141
Polymorphisms
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D14Mit141 a 113bp SPRET/EiJ
b 123bp NON/ShiLt
c 125bp A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J
d 127bp NOD/MrkTac
e 139bp CAST/EiJ
f 141bp B6.Cg-Lepob/+, C57BL/6J
g 145bp LP/J
J:55077 Le Voyer TE, et al., Mamm Genome. 1999 Jun;10(6):542-3
Endonuclease Gene Allele Fragments Strains
D14Mit141 c larger C58/J
f not given FVB/NJ
i not given I/LnJ
J:67963 Iraqi F, MGI Direct Data Submission. 2001;
Endonuclease Gene Allele Fragments Strains
D14Mit141 c 124bp CBA/CaOlaHsd
s 127bp SWR/OlaHsd
References
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:55077 Le Voyer TE, et al., Microsatellite DNA variants among the FVB/NJ, C58/J, and I/LnJ mouse strains. Mamm Genome. 1999 Jun;10(6):542-3
J:67963 Iraqi F, Polymorphisms of 513 SSLP microsatellite markers among CBA and SWR. MGI Direct Data Submission. 2001;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
06/16/2026
MGI 6.24
The Jackson Laboratory