D3Mit6 Primer Detail MGI Mouse MGI:703424

D3Mit6 Primer Detail

Name

D3Mit6
Primer 1 Sequence

AACTTCAACATGTGAGGGGC
Primer 2 Sequence

CCTGAAACAAAGCAACAGCA
ID

MGI:703424
Product Size

144
Other IDs

D3Mit6 (BROAD)
Note

MIT assay: M149
Additional information: MIT STS Marker Data Files

D3Mit6

DNA segment, Chr 3, Massachusetts Institute of Technology 6

J:40662 Threadgill DW, et al., Mamm Genome. 1997 Jun;8(6):441-2

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D3Mit6	a	142bp	129X1/Sv
Not Specified	D3Mit6	f	136bp	CD-1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Gene	Allele	Fragments	Strains
D3Mit6	a	125bp	SPRET/EiJ
	b	133bp	CAST/EiJ
	c	136bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, DBA/2J, NOD/MrkTac, NON/ShiLt
	d	145bp	B6.Cg-Lep^ob/+
	e	147bp	C57BL/6J, LP/J

J:40662 Threadgill DW, et al., SSLPs to map genetic differences between the 129 inbred strains and closed-colony, random-bred CD-1 mice. Mamm Genome. 1997 Jun;8(6):441-2

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 05/07/2024 MGI 6.23