D3Mit7 Primer Detail MGI Mouse MGI:703423

D3Mit7 Primer Detail

Name

D3Mit7
Primer 1 Sequence

ATGCAACTAACTTTATTGAAAATC
Primer 2 Sequence

TACAATTATCCGGGAGCTA
ID

MGI:703423
Product Size

147
Other IDs

D3Mit7 (BROAD)
Note

MIT assay: M74
Additional information: MIT STS Marker Data Files

D3Mit7

DNA segment, Chr 3, Massachusetts Institute of Technology 7

J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9

Endonuclease	Gene	Allele	Fragments	Strains
Not Specified	D3Mit7	a	largest	MSM/Ms
Not Specified	D3Mit7	b	smaller	C57BL/6, DBA/2, JF1

J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;

Endonuclease	Gene	Allele	Fragments	Strains
	D3Mit7	a	142bp	A/J, AKR/J, BALB/cJ, C3H/HeJ, CAST/EiJ, LP/J, NOD/MrkTac, NON/ShiLt
	D3Mit7	b	147bp	B6.Cg-Lep^ob/+, C57BL/6J, DBA/2J, SPRET/EiJ

J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9

J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;

J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects: Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources Funding Information Warranty Disclaimer, Privacy Notice, Licensing, & Copyright Send questions and comments to User Support.	last database update 09/30/2025 MGI 6.24