About   Help   FAQ
D3Mit7 Primer Detail
Primers
  • Name
    D3Mit7
  • Primer 1 Sequence
    ATGCAACTAACTTTATTGAAAATC
  • Primer 2 Sequence
    TACAATTATCCGGGAGCTA
  • ID
    MGI:703423
  • Product Size
    147
  • Other IDs
    D3Mit7 (BROAD)
  • Note
    MIT assay: M74
    Additional information: MIT STS Marker Data Files
Genes
D3Mit7 DNA segment, Chr 3, Massachusetts Institute of Technology 7
Polymorphisms
J:42684 Koide T, et al., Mamm Genome. 1998 Jan;9(1):15-9
Endonuclease Gene Allele Fragments Strains
Not Specified D3Mit7 a largest MSM/Ms
b smaller C57BL/6, DBA/2, JF1
J:34136 Whitehead Institute at MIT, et al., Database Release. 1999;
Endonuclease Gene Allele Fragments Strains
D3Mit7 a 142bp A/J, AKR/J, BALB/cJ, C3H/HeJ, CAST/EiJ, LP/J, NOD/MrkTac, NON/ShiLt
b 147bp B6.Cg-Lepob/+, C57BL/6J, DBA/2J, SPRET/EiJ
References
J:42684 Koide T, et al., A new inbred strain JF1 established from Japanese fancy mouse carrying the classic piebald allele [published erratum appears in Mamm Genome 1998 Apr;9(4):344]. Mamm Genome. 1998 Jan;9(1):15-9
J:34136 Whitehead Institute at MIT, et al., Genetic and Physical Maps of the Mouse, Database Release. Database Release. 1999;
J:106743 Mouse Genome Informatics and NCBI UniSTS, UniSTS load for MIT markers. Database Download. 2006;

Contributing Projects:
Mouse Genome Database (MGD), Gene Expression Database (GXD), Mouse Models of Human Cancer database (MMHCdb) (formerly Mouse Tumor Biology (MTB)), Gene Ontology (GO)
Citing These Resources
Funding Information
Warranty Disclaimer, Privacy Notice, Licensing, & Copyright
Send questions and comments to User Support.
last database update
03/18/2025
MGI 6.24
The Jackson Laboratory